Rther fuelled by a flurry of other collateral activities that, collectively
Rther fuelled by a flurry of other collateral activities that, collectively, serve to perpetuate...
Nter and exit’ (Bauman, 2003, p. xii). His observation that our occasions
Nter and exit’ (Bauman, 2003, p. xii). His observation that our occasions have seen...
Rated ` analyses. Inke R. Konig is Professor for Health-related Biometry and
Rated ` analyses. Inke R. Konig is Professor for Medical Biometry and Statistics in...
General clustering of the greatest signalling responses to insulin within the
General clustering of the greatest signalling responses to insulin within the more insulin sensitive...
Erformed with Microsoft Excel 2010 and R version 2.11.1.hTAAR9_fwd2: GCATATGAATTCATGGTGAACAATTTCTCCCAAG hTAAR
Erformed with Microsoft Excel 2010 and R version 2.11.1.hTAAR9_fwd2: GCATATGAATTCATGGTGAACAATTTCTCCCAAG hTAAR9_rv2: GCTATCAGTAATGTTTTTAATCTGTCTCTACTTCTTCStatisticsFor electrophysiological BMS-790052...
Visualize the hybridization signal directly. The chromosome slides were counterstained with
Visualize the hybridization signal directly. The chromosome slides were counterstained with propidium iodide (Sigma,...
Opment, or both. We speculate that there may be interspecies differences
Opment, or both. We speculate that there may be interspecies differences in the regulation...
With 150,000 reads and average read length of 100 bp in simulation study
With 150,000 reads and average read length of 100 bp in simulation study 1....
Inability to colocalize with lipid rafts. The process of oligomerization may
Inability to colocalize with lipid rafts. The process of oligomerization may induce the formation...