Subsequently purified by MicroSpin G-25 columns (Amersham Biosciences, Europe). Ss-duplex substrates

Subsequently purified by MicroSpin G-25 columns (Amersham Biosciences, Europe). Ss-duplex substrates were obtained by annealing the labelled forward oligonucleotide with equimolar amounts of the reverse, partially complement cold oligonucleotide (Table 1). Drug reactions with the labelled ss-duplex (5 pmol/ sample) were performed at 37uC in 50 mM phosphate buffer, pH 7.4. These conditions were selected to maintain the stability of the target oligonucleotide structures and to minimize the possible competition of buffer molecules for drug alkylation [21]. At the indicated time intervals, samples were precipitated with ethanol to eliminate non-reacted drug, then resuspended and either kept on ice, or treated at 90uC for 30 min with 1 M piperidine to complete strand scission according to the Maxam and Gilbert protocol [22]. Samples were then lyophilised, resuspended in formamide gel loading buffer, and heated at 95uC for 3 min. Reaction products were analyzed on 20 denaturing polyacrylamide gels. Gels were visualized by phosphorimaging analysis (Typhoon FLA 9000, GE Healthcare, Europe).Clerocidin Dissects DNA 1081537 Secondary StructureTable 1. Oligonucleotides used in this study.Oligonucleotide Type Mismatch G Name 1 1 rev 1 1a rev 1 2 rev 1 3 rev Mismatch C 4 1 rev 5 1a rev Bulge G A/T rich 1 1b rev 1 1c rev 1 1d rev 6 1d rev 7 1d rev Bulge G G/C rich 8 8 rev 9 9 rev 10 10 rev 11 10 rev 12 10 rev Bulge C A/T rich 5 1b rev 1 1c rev 5 1d rev 13 1d rev 14 1d rev Bulge C G/C rich 17 8 rev 18 Sequence CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTATAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTAAAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTATCAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTGTCAATAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAGCT AGCTTATAATGGTTATAAATAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAAGCT AGCTTATAATGGTTAAAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTAAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT TA 01 AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTATTTTGTTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTATTTTTGTTTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTACGCGCGCCCATTATAAGCT AGCTTATAATGGGCGGCGTAAAGCAATAG CTATTGCTTTCGCTGCGCCCATTATAAGCT AGCTTATAATGGGCGGCGTAAAGCAATAG CTATTGCTTTCGCTGTCGCCATTATAAGCT 23727046 AGCTTATAATGGCGGCGAAAGCAATAG CTATTGCTTTCGCTTGTTCGCCATTATAAGCT AGCTTATAATGGCGGCGAAAGCAATAG CTATTGCTTTCGCTTTGTTTCGCCATTATAAGCT AGCTTATAATGGCGGCGAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAAGCT AGCTTATAATGGTTAAAATAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAAGCT AGCTTATAATGGTTAAATAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTATTTTCTTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTATTTTTCTTTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG Tunicamycin biological activity CTATTGCTTTACGCCCGCCCATTATAAGCT AGCTTATAATGGGCGGCGTAAAGCAATAG CTATTGCTTTCGCTCCGCCCATTATAAGCT B2 C G/C rich B1 C G/C rich B7 C A/T rich B5 C A/T rich B3 C A/T rich B2 C A/T rich B1 C A/T rich B7 G G/C rich B5 G G/C rich B3 G G/C rich B2 G G/C rich B1 G G/C rich B7 G A/T rich B5 G A/T rich B3 G A/T rich B2 G A/T rich B1 G A/T rich MM C/A MM C/T MM TGT/GTC MM TG/TC MM G/A Abbreviated description MM G/TClerocidin Dissects DNA Secondary StructureTable 1. Cont.Oligonucleotide Type Name 9 rev 19 10 rev 20 10 rev 21 10 rev Nick G A/T rich 1 11 rev 12 rev 1 11 rev 13 rev 1 14 rev 13 rev Nick G G/C rich 8 15 rev 16 rev 22 17 rev 18 rev 23 19 rev 18 rev Nick C A/T rich 24 11 rev 12 rev 24 11 rev 13 rev 24.Subsequently purified by MicroSpin G-25 columns (Amersham Biosciences, Europe). Ss-duplex substrates were obtained by annealing the labelled forward oligonucleotide with equimolar amounts of the reverse, partially complement cold oligonucleotide (Table 1). Drug reactions with the labelled ss-duplex (5 pmol/ sample) were performed at 37uC in 50 mM phosphate buffer, pH 7.4. These conditions were selected to maintain the stability of the target oligonucleotide structures and to minimize the possible competition of buffer molecules for drug alkylation [21]. At the indicated time intervals, samples were precipitated with ethanol to eliminate non-reacted drug, then resuspended and either kept on ice, or treated at 90uC for 30 min with 1 M piperidine to complete strand scission according to the Maxam and Gilbert protocol [22]. Samples were then lyophilised, resuspended in formamide gel loading buffer, and heated at 95uC for 3 min. Reaction products were analyzed on 20 denaturing polyacrylamide gels. Gels were visualized by phosphorimaging analysis (Typhoon FLA 9000, GE Healthcare, Europe).Clerocidin Dissects DNA 1081537 Secondary StructureTable 1. Oligonucleotides used in this study.Oligonucleotide Type Mismatch G Name 1 1 rev 1 1a rev 1 2 rev 1 3 rev Mismatch C 4 1 rev 5 1a rev Bulge G A/T rich 1 1b rev 1 1c rev 1 1d rev 6 1d rev 7 1d rev Bulge G G/C rich 8 8 rev 9 9 rev 10 10 rev 11 10 rev 12 10 rev Bulge C A/T rich 5 1b rev 1 1c rev 5 1d rev 13 1d rev 14 1d rev Bulge C G/C rich 17 8 rev 18 Sequence CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTATAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTAAAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTATCAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTGTCAATAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAGCT AGCTTATAATGGTTATAAATAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAAGCT AGCTTATAATGGTTAAAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTAAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTAAATAAAGCAATAG CTATTGCTTTATTTGTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTATTTTGTTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTATTTTTGTTTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTACGCGCGCCCATTATAAGCT AGCTTATAATGGGCGGCGTAAAGCAATAG CTATTGCTTTCGCTGCGCCCATTATAAGCT AGCTTATAATGGGCGGCGTAAAGCAATAG CTATTGCTTTCGCTGTCGCCATTATAAGCT 23727046 AGCTTATAATGGCGGCGAAAGCAATAG CTATTGCTTTCGCTTGTTCGCCATTATAAGCT AGCTTATAATGGCGGCGAAAGCAATAG CTATTGCTTTCGCTTTGTTTCGCCATTATAAGCT AGCTTATAATGGCGGCGAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAAGCT AGCTTATAATGGTTAAAATAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAAGCT AGCTTATAATGGTTAAATAAAGCAATAG CTATTGCTTTATTTCTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTATTTTCTTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTATTTTTCTTTAACCATTATAAGCT AGCTTATAATGGTTAATAAAGCAATAG CTATTGCTTTACGCCCGCCCATTATAAGCT AGCTTATAATGGGCGGCGTAAAGCAATAG CTATTGCTTTCGCTCCGCCCATTATAAGCT B2 C G/C rich B1 C G/C rich B7 C A/T rich B5 C A/T rich B3 C A/T rich B2 C A/T rich B1 C A/T rich B7 G G/C rich B5 G G/C rich B3 G G/C rich B2 G G/C rich B1 G G/C rich B7 G A/T rich B5 G A/T rich B3 G A/T rich B2 G A/T rich B1 G A/T rich MM C/A MM C/T MM TGT/GTC MM TG/TC MM G/A Abbreviated description MM G/TClerocidin Dissects DNA Secondary StructureTable 1. Cont.Oligonucleotide Type Name 9 rev 19 10 rev 20 10 rev 21 10 rev Nick G A/T rich 1 11 rev 12 rev 1 11 rev 13 rev 1 14 rev 13 rev Nick G G/C rich 8 15 rev 16 rev 22 17 rev 18 rev 23 19 rev 18 rev Nick C A/T rich 24 11 rev 12 rev 24 11 rev 13 rev 24.